View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18477_low_4 (Length: 267)
Name: NF18477_low_4
Description: NF18477
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18477_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 124; Significance: 7e-64; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 11 - 159
Target Start/End: Complemental strand, 36344898 - 36344748
Alignment:
| Q |
11 |
gaacctgtgataaatcgaaacacaca--tttgaaaattccaaaaatgattcataacatatccaaaaatggtaccaaagtgtagcacacaccaaatacatg |
108 |
Q |
| |
|
|||||||||| ||||| ||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36344898 |
gaacctgtgaaaaatcaaaacacacacatttgaaaatttcaaaaatgattcataacatatccaaaaatggtaccaaagtgtagcacacaccaaatacatg |
36344799 |
T |
 |
| Q |
109 |
tatcatagcttataattactatgatatacatagacactaacacactatagt |
159 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
36344798 |
tatcatagcttataattacaatgatatacatagacactaacacactatagt |
36344748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 42 - 77
Target Start/End: Original strand, 8369971 - 8370006
Alignment:
| Q |
42 |
aaattccaaaaatgattcataacatatccaaaaatg |
77 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| |
|
|
| T |
8369971 |
aaattctaaaaatgattcataacatatccaaaaatg |
8370006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University