View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18478_low_14 (Length: 228)
Name: NF18478_low_14
Description: NF18478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18478_low_14 |
 |  |
|
| [»] scaffold1335 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold1335 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: scaffold1335
Description:
Target: scaffold1335; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 19 - 210
Target Start/End: Complemental strand, 1876 - 1696
Alignment:
| Q |
19 |
cttgtgctggaaatggtacaaatacagcatgtggtttttgttgggtatgatgaggattagactccattttaatcaatttgtttttcttgagaatttttgt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
1876 |
cttgtgctggaaatggtacaaatacagcatgtggtttttgttgggtatgatgaggattagactccattttaatcaatttatttttcttgaatatttttgt |
1777 |
T |
 |
| Q |
119 |
attgtgggattgatatttttgtgggtcaatttcagttatttcaatagcactatatgcttgtgaagaagaagtgaagaactaaacaactagta |
210 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1776 |
attgtgggattgatatttttgtg-----------gttatttcaatagcactatatgcttgtgaagaagaagtgaagaactaaacaactagta |
1696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 61
Target Start/End: Original strand, 35776367 - 35776409
Alignment:
| Q |
19 |
cttgtgctggaaatggtacaaatacagcatgtggtttttgttg |
61 |
Q |
| |
|
||||| ||||||||||||||||||||||||| || |||||||| |
|
|
| T |
35776367 |
cttgtactggaaatggtacaaatacagcatgaggcttttgttg |
35776409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University