View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18478_low_9 (Length: 308)
Name: NF18478_low_9
Description: NF18478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18478_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 49; Significance: 5e-19; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 8 - 56
Target Start/End: Complemental strand, 41420045 - 41419997
Alignment:
| Q |
8 |
gagatcgtcaggaggatgcgggtgcgctaacagaatatcatccgaagaa |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41420045 |
gagatcgtcaggaggatgcgggtgcgctaacagaatatcatccgaagaa |
41419997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 8 - 56
Target Start/End: Original strand, 39226114 - 39226162
Alignment:
| Q |
8 |
gagatcgtcaggaggatgcgggtgcgctaacagaatatcatccgaagaa |
56 |
Q |
| |
|
|||||||| ||||| ||| ||||| |||||||||||||||||||||||| |
|
|
| T |
39226114 |
gagatcgttaggagaatgtgggtgtgctaacagaatatcatccgaagaa |
39226162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 8 - 53
Target Start/End: Complemental strand, 41897520 - 41897476
Alignment:
| Q |
8 |
gagatcgtcaggaggatgcgggtgcgctaacagaatatcatccgaa |
53 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
41897520 |
gagatcttcagg-ggatgcgggtgcgctaacagaatatcattcgaa |
41897476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University