View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18478_low_9 (Length: 308)

Name: NF18478_low_9
Description: NF18478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18478_low_9
NF18478_low_9
[»] chr3 (1 HSPs)
chr3 (8-56)||(41419997-41420045)
[»] chr1 (1 HSPs)
chr1 (8-56)||(39226114-39226162)
[»] chr7 (1 HSPs)
chr7 (8-53)||(41897476-41897520)


Alignment Details
Target: chr3 (Bit Score: 49; Significance: 5e-19; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 8 - 56
Target Start/End: Complemental strand, 41420045 - 41419997
Alignment:
8 gagatcgtcaggaggatgcgggtgcgctaacagaatatcatccgaagaa 56  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||    
41420045 gagatcgtcaggaggatgcgggtgcgctaacagaatatcatccgaagaa 41419997  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 8 - 56
Target Start/End: Original strand, 39226114 - 39226162
Alignment:
8 gagatcgtcaggaggatgcgggtgcgctaacagaatatcatccgaagaa 56  Q
    |||||||| ||||| ||| ||||| ||||||||||||||||||||||||    
39226114 gagatcgttaggagaatgtgggtgtgctaacagaatatcatccgaagaa 39226162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 8 - 53
Target Start/End: Complemental strand, 41897520 - 41897476
Alignment:
8 gagatcgtcaggaggatgcgggtgcgctaacagaatatcatccgaa 53  Q
    |||||| ||||| |||||||||||||||||||||||||||| ||||    
41897520 gagatcttcagg-ggatgcgggtgcgctaacagaatatcattcgaa 41897476  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University