View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18479_low_4 (Length: 274)
Name: NF18479_low_4
Description: NF18479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18479_low_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 14 - 257
Target Start/End: Complemental strand, 521527 - 521281
Alignment:
| Q |
14 |
actcggggaaagaaattgcgacgaaggaggaggataatgaatgttttgaaatcatgaataaaatcaacctaataaatttagatgtttggagcaactacca |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||| || || || |
|
|
| T |
521527 |
actcggggaaagaaattgcgacgaaggaggaggataatgaatgttttcaaatcataaataaaatcaacctaataaatttagatgttttga--aatcacgt |
521430 |
T |
 |
| Q |
114 |
tt-----ggaaaccaacaaccaaacagtctaagtaacaacaagcaaaaaattgtaaagtaaaatcacaatcttaatcaaaggacaaacatagagagagta |
208 |
Q |
| |
|
|| | | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
521429 |
ttttctagtagtgcaacaaccaaacagtctaagtaacaacaagcaaaaaattgtaaagtaaaatcacaatcttaatcaaaggacaaagatagagagagta |
521330 |
T |
 |
| Q |
209 |
gaggaagaaatacaccaagatttggtttctaggttcggcccaacaatga |
257 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
521329 |
gaggaagaaatacactaagatttggtttctaggttcggcccaacaatga |
521281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University