View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1847_high_17 (Length: 236)
Name: NF1847_high_17
Description: NF1847
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1847_high_17 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 78; Significance: 2e-36; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 1 - 86
Target Start/End: Complemental strand, 14086228 - 14086143
Alignment:
| Q |
1 |
ttttgtattgtcgacaatatagatgaaaataaaaacaaaacgaatgaaaagatatttatagaatatagacgactactgggaatttt |
86 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14086228 |
ttttgtattgtcgaaaatatagaagaaaataaaaacaaaacgaatgaaaagatatttatagaatatagacgactactgggaatttt |
14086143 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 151 - 220
Target Start/End: Complemental strand, 14086079 - 14086010
Alignment:
| Q |
151 |
tcattgtcaaggataagatatattgttactatacgtaattatttttggttagagttcatgatatcatacg |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
14086079 |
tcattgtcaaggataagatatattgttactatacgtaattatttttggttagagttcttgatatcatacg |
14086010 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 86 - 129
Target Start/End: Complemental strand, 14086117 - 14086074
Alignment:
| Q |
86 |
tgtgtgtgtctctttcactcttttgtctttaggtaatatcattg |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14086117 |
tgtgtgtgtctctttcactcttttgtctttaggtaatatcattg |
14086074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University