View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1847_low_10 (Length: 271)
Name: NF1847_low_10
Description: NF1847
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1847_low_10 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 1 - 158
Target Start/End: Original strand, 17592096 - 17592257
Alignment:
| Q |
1 |
gcaaagaaccagaaaaataaaccacgagcaa-gggaaccacc---gaggagaaaccccaaaccaaactgagcaagacagaaccagaagccatgctcccag |
96 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
17592096 |
gcaaagaaccagaaaaacaaaccacgagcaaagggaaccaccaacgaggagaaaccccaaaccaaactgagcaagacagaaccagaagtcatgctcccag |
17592195 |
T |
 |
| Q |
97 |
aattggacaacaaccaaaacaagcaagacatgaaattaaggtgcaaaagttaaacagcaata |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17592196 |
aattggacaacaaccaaaacaagcaagacatgaaattaaggtgcaaaagttaaacagcaata |
17592257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 197 - 255
Target Start/End: Original strand, 17592367 - 17592425
Alignment:
| Q |
197 |
tctagcatattacaatatggtttgaagagcgggccactcctcacttattagctttatgt |
255 |
Q |
| |
|
|||||||||||| |||||| || |||| |||||||| || || |||||||||||||||| |
|
|
| T |
17592367 |
tctagcatattataatatgcttcgaagggcgggccattcatcccttattagctttatgt |
17592425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University