View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1847_low_13 (Length: 263)
Name: NF1847_low_13
Description: NF1847
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1847_low_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 164; Significance: 1e-87; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 3801604 - 3801380
Alignment:
| Q |
1 |
taacaatataatatgtgtgatagtgtgtacggtagattaagatcaacagaagataatacattttaatgtggttttcaagtcttgatctgattgatannnn |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
3801604 |
taacaatataatatgtgtgatagtgtgtacggtagattaagatcaacagaagataatacattttaatgtggttttcaagacttgatctgattgatttttt |
3801505 |
T |
|
| Q |
101 |
nnnnnn------aaggaatcttgatctgattgattaacacttgtcaaagtggcctgaaaaaatgcatttgtttagaatattatgattatgattttgtttc |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3801504 |
tttttttttgttaaggaatcttgatctgattgattaacacttgtcaaagtggcctgaaaaaatgcatttgtttagaatattatgattatgattttgtttc |
3801405 |
T |
|
| Q |
195 |
aaaaggaataattatgagagcgttt |
219 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
3801404 |
aaaaggaataattatgagagcgttt |
3801380 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University