View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1847_low_16 (Length: 244)
Name: NF1847_low_16
Description: NF1847
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1847_low_16 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 14185481 - 14185247
Alignment:
| Q |
1 |
taggaccttcaccctttcagtgacataagagaattgta--------taagtttataaaaatatttaaattctaaaaattgtgtatataacgatgcttata |
92 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14185481 |
taggaccttcaccctttcagtgacataagagaattgtacaagtgtataagtttataaaaatatttaaattctaaaaattgtgtatataacgatgcttata |
14185382 |
T |
|
| Q |
93 |
tgatctttgatgttttgttttagtcattataaaattcatttctcctcaggaaatcattggcatgcgcatatttaaccatcagagacaaaacttctatgtt |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
14185381 |
tgatctttgatgttttgttttagtcattataaaattcatttctcctcaagaaatcattggcatgcacatatttaaccatcagagacaaaacttctatgtt |
14185282 |
T |
|
| Q |
193 |
tcgcctacatgcatcaagagagataaaattatatt |
227 |
Q |
| |
|
|||||||||| ||||||||||||||||||| |||| |
|
|
| T |
14185281 |
tcgcctacatacatcaagagagataaaattgtatt |
14185247 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University