View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1847_low_20 (Length: 223)
Name: NF1847_low_20
Description: NF1847
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1847_low_20 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 13 - 208
Target Start/End: Complemental strand, 31156180 - 31155983
Alignment:
| Q |
13 |
attctacaatgtgtctttctcagtcaatttagttcataaaattaagaacacaagacatgtttgaatatgtttttgtaattttgatacggtaaaagactat |
112 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
31156180 |
attctacaatgtgtctttcttagtcaatttaattcataaaattaagaacacaagacatgtttgaatatgtttttgtaattttgataaggtaaaagactat |
31156081 |
T |
|
| Q |
113 |
agtaaaaacacctcgcgtatatttaagtatcaaaacgagtgtattactcacatat--cacacatatggccatcttccaccattgttaccatggaaact |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||| || ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31156080 |
agtaaaaacacctcgcgtatatttaagtatcaaaacgagtttattactcacaaatcacacacatatggccatcttccaccattgttaccatggaaact |
31155983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University