View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1847_low_9 (Length: 276)
Name: NF1847_low_9
Description: NF1847
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1847_low_9 |
 |  |
|
| [»] scaffold0085 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0085 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: scaffold0085
Description:
Target: scaffold0085; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 19 - 266
Target Start/End: Complemental strand, 52634 - 52387
Alignment:
| Q |
19 |
gatgaaggaaaagatagtagattataatatagtaaaagaattgaattttgatatttgacacgactagaaagaaagaagnnnnnnntctcattccagttaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| | |||||||| |||| |
|
|
| T |
52634 |
gatgaaggaaaagatagtagattataatacagtaaaagaattgaattttgatatttgacacgactagaaagaaagaagaaaaaaatttcattccaattaa |
52535 |
T |
 |
| Q |
119 |
tttgataagctggacatccggatcaaaaacttttgctatatgcaagtcactgttgcaaaccaatgatatgatccaaaatggtcaattaccgaaagagcct |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52534 |
tttgataagctggacatccggatcaaaaacttttgctatatgcaagtcactgttgcaaaccaatgatatgatccaaaatggtcaattaccgaaagagcct |
52435 |
T |
 |
| Q |
219 |
cgggactgttttcttaaatgcttttccttcaagctttagtcgcctatg |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52434 |
cgggactgttttcttaaatgcttttccttcaagctttagtcgcctatg |
52387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University