View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18481_high_37 (Length: 266)
Name: NF18481_high_37
Description: NF18481
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18481_high_37 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 102; Significance: 1e-50; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 12 - 113
Target Start/End: Original strand, 10690357 - 10690458
Alignment:
| Q |
12 |
cgtgcttcatagttatagttacagacacgagatacaacactaacactgacacatatatagtatcccacatttgagaaattcaaaaattagaggaaaatgt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10690357 |
cgtgcttcatagttatagttacagacacgagatacaacactaacactgacacatatatagtatcccacatttgagaaattcaaaaattagaggaaaatgt |
10690456 |
T |
|
| Q |
112 |
ga |
113 |
Q |
| |
|
|| |
|
|
| T |
10690457 |
ga |
10690458 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 179 - 238
Target Start/End: Original strand, 10690524 - 10690583
Alignment:
| Q |
179 |
atgtagaagtgagttttcctttccatctttggtgttgtgctttacgtttctgtacttcat |
238 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
10690524 |
atgtataagtgagttttcctttccatctttggtgttgtgctttacgtttctgtaattcat |
10690583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University