View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18481_high_40 (Length: 250)
Name: NF18481_high_40
Description: NF18481
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18481_high_40 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 9 - 250
Target Start/End: Original strand, 45668069 - 45668311
Alignment:
| Q |
9 |
agcacagaagaatctaccgcagatttgtactaatcaccttgatcctacatcggtaatcataatcattgataattgatttcaattttgtcaactagttagg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45668069 |
agcacagaagaatctaccgcagatttgtactaatcaccttgatcctacatcggtaatcataatcattgataattgatttcaattttgtcaactagttagg |
45668168 |
T |
 |
| Q |
109 |
-agtcttagtttcattcgaaagaacagaaaatagatatctctgctaatgcttgcttataacttgaactttcagtgactggttttattactcctttttcag |
207 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45668169 |
gagtcttagtttcattcaaaagaacagaaaatagatctctctgctaatgcttgcttataacttgaactttcagtgactggttttattactcctttttcag |
45668268 |
T |
 |
| Q |
208 |
tgtttcttccctcagaatttgattgtcagtgttagaacaccac |
250 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
45668269 |
tgtttcttccctcagaatttgattgccagtgttagaacaccac |
45668311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University