View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18481_high_43 (Length: 243)
Name: NF18481_high_43
Description: NF18481
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18481_high_43 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 215; Significance: 1e-118; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 14 - 228
Target Start/End: Complemental strand, 3238990 - 3238776
Alignment:
| Q |
14 |
aatatcgaaaacatacaaaaattgagcacatgacaatgatgatatgtgtatgtagtaaattggaatttactcagagcatgaatagcctttgaggaagaaa |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3238990 |
aatatcgaaaacatacaaaaattgagcacatgacaatgatgatatgtgtatgtagtaaattggaatttactcagagcatgaatagcctttgaggaagaaa |
3238891 |
T |
|
| Q |
114 |
ctttctgagtacgtcttagaatcacatttggagaagttattaatcgtccatgtgaattgctcaatcgtccctggggatttcttctcaattgctttactgt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3238890 |
ctttctgagtacgtcttagaatcacatttggagaagttattaatcgtccatgtgaattgctcaatcgtccctggggatttcttctcaattgctttactgt |
3238791 |
T |
|
| Q |
214 |
ttcagtgatgattct |
228 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
3238790 |
ttcagtgatgattct |
3238776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 117 - 190
Target Start/End: Complemental strand, 3243022 - 3242949
Alignment:
| Q |
117 |
tctgagtacgtcttagaatcacatttggagaagttattaatcgtccatgtgaattgctcaatcgtccctgggga |
190 |
Q |
| |
|
||||||||| ||| ||||||||| || |||||||| ||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
3243022 |
tctgagtacatctgagaatcacacttagagaagttcttaatcgtccatgtgaattgctcaatcgtccatgggga |
3242949 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University