View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18481_high_48 (Length: 217)
Name: NF18481_high_48
Description: NF18481
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18481_high_48 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 16 - 193
Target Start/End: Complemental strand, 25545173 - 25544996
Alignment:
| Q |
16 |
cacagaaaaggaaccgaaggaatcaatggcataatccaactcaaccaaaatagattgggaaacaaactatgaaacatcaacaacatagatgcagaaatcg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25545173 |
cacagaaaaggaaccgaaggaatcaatggcataatccaactcaaccaaaatagattgggaaacaaactatgaaacatcaacaacatagatgcagaaatcg |
25545074 |
T |
 |
| Q |
116 |
agaggctatactgctacgctatccaaaacttcaatgttttgactcaaagccaaaaccaacaagatattttctcataca |
193 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
25545073 |
agaggctatattgctacgctatccaaaacttcaatgttttgactcaaagccaaaaccaacaagatcttttctcataca |
25544996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 16 - 193
Target Start/End: Original strand, 1154569 - 1154744
Alignment:
| Q |
16 |
cacagaaaaggaaccgaaggaatcaatggcataatccaactcaaccaaaatagattgggaaacaaactatgaaacatcaacaacatagatgcagaaatcg |
115 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||| || |||||||||||||||||||| | |
|
|
| T |
1154569 |
cacagaaaaggaaccgaaggaattaatggcataatccaacacaaccaaaatagattgggaaacaaactatgaactatgaacaacatagatgcagaaattg |
1154668 |
T |
 |
| Q |
116 |
agaggctatactgctacgctatccaaaacttcaatgttttgactcaaagccaaaaccaacaagatattttctcataca |
193 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||| ||||| ||| || |||||||||||||||||| |
|
|
| T |
1154669 |
agaggctatattgctacgctatccaaaacttcaatgttttgactc--agccacaactaataagatattttctcataca |
1154744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University