View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18481_low_17 (Length: 422)
Name: NF18481_low_17
Description: NF18481
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18481_low_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 98; Significance: 4e-48; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 98; E-Value: 4e-48
Query Start/End: Original strand, 57 - 154
Target Start/End: Complemental strand, 18821929 - 18821832
Alignment:
| Q |
57 |
cgctcctttggttttaagacatcaaagaacctcatctgctattgcatctagcaataaattatgttgctattgtaagtcattcttgaatatatgaattt |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18821929 |
cgctcctttggttttaagacatcaaagaacctcatctgctattgcatctagcaataaattatgttgctattgtaagtcattcttgaatatatgaattt |
18821832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 158 - 289
Target Start/End: Complemental strand, 18821598 - 18821461
Alignment:
| Q |
158 |
catttgtcttatattgagcctgatcctatgaacatgtactattcatcttggactatcaacattcatttgtggaggttgtgttgga------gttgagtct |
251 |
Q |
| |
|
||||||||||||||||||||| |||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
18821598 |
catttgtcttatattgagcctcatccgatgaacatttactattcatcttggactatcaacattcatttgtggaggttgtgttggagttggagttgagtct |
18821499 |
T |
 |
| Q |
252 |
tcttagtttgccatgttgcttgttgactcataatggtt |
289 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
18821498 |
tcttggtttgccatgttgtttgttgactcataatggtt |
18821461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University