View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18481_low_41 (Length: 249)
Name: NF18481_low_41
Description: NF18481
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18481_low_41 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 33 - 239
Target Start/End: Original strand, 28319339 - 28319545
Alignment:
| Q |
33 |
acactgggcacagtaatagtaatttggcttaataacaaacttcaactttagtaaaattaattcgaaattgcattgtcaccatcccaccacctaagttgta |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28319339 |
acactgggcacagtaatagtaatttggcttaataacaaacttcaactttagtaaaattaattcgaaattgcattgtcaccatcccaccacctaagttgta |
28319438 |
T |
 |
| Q |
133 |
tagttcttttcttcatctttattgttctttgattttgtgtttatattcaacaaatttgtccagtcaaaatacaataaaaggtaaacttgctcatcaaaat |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28319439 |
tagttcttttcttcatctttattgttctttgattttgtgtttatattcaacaaatttgtccagtcaaaatacaataaaaggtaaacttgctcatcaaaat |
28319538 |
T |
 |
| Q |
233 |
acctatg |
239 |
Q |
| |
|
||||||| |
|
|
| T |
28319539 |
acctatg |
28319545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University