View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18482_high_29 (Length: 261)
Name: NF18482_high_29
Description: NF18482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18482_high_29 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 93 - 248
Target Start/End: Original strand, 45642222 - 45642377
Alignment:
| Q |
93 |
gactgatgacattaaagggttccaatgataataactatgcaatcagtattctattgttctctgctgttgtttgtattataattatcgaaaaatgttggac |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45642222 |
gactgatgacattaaagggttccaatgataataactatgcaatcagtattctattgttctctgctgttgtttgtattataattatcgaaaaatgttggac |
45642321 |
T |
|
| Q |
193 |
cctcttctgttaatgctgatgaagtatttggccagatttcttttgatgccgtccct |
248 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
45642322 |
cctcttctgttaatgctgatgcagtatttggccagatttcttttgatgccatccct |
45642377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University