View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18482_high_34 (Length: 238)
Name: NF18482_high_34
Description: NF18482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18482_high_34 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 161; Significance: 5e-86; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 6081784 - 6082007
Alignment:
| Q |
1 |
tacgtgcactttgccgtttaccttataa-ttgtacaactcaacaaacttctatcttcaagagttaaccgagtatttttaccactcnnnnnnnn--atggt |
97 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
6081784 |
tacgtgcactttgccgtttaccttataaattgtacaactcaacaaacttctatcttcaagagttaaccgagtatttttaccactattttttttttatggt |
6081883 |
T |
 |
| Q |
98 |
gatgtttagtatttaatgtatattcttatcattgcctctcaaggcttatgtccgtttttaacattttcagttcagttgcatcacctagaaaaccttgtcc |
197 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||| |||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
6081884 |
gatgtttagtatttaatgtatattcttaccattgcctctcaaggctgatgtccatttttaacattttcagttcagttccatcacctagaaaaccttgtcc |
6081983 |
T |
 |
| Q |
198 |
aactagagccatgcaccaacatgc |
221 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
6081984 |
aactagagccatgcaccaacatgc |
6082007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 50 - 195
Target Start/End: Complemental strand, 6118933 - 6118788
Alignment:
| Q |
50 |
tatcttcaagagttaaccgagtatttttaccactcnnnnnnnnatggtgatgtttagtatttaatgtatattcttatcattgcctctcaaggcttatgtc |
149 |
Q |
| |
|
|||||||||||| ||||||| ||||||||| ||| || |||||||||| |||||||| | |||||||| |||||||| |||||||| ||||| |
|
|
| T |
6118933 |
tatcttcaagagctaaccgaatatttttactactgttttttatatagtgatgtttaatatttaatatttattcttaccattgcctttcaaggctgatgtc |
6118834 |
T |
 |
| Q |
150 |
cgtttttaacattttcagttcagttgcatcacctagaaaaccttgt |
195 |
Q |
| |
|
|||| ||| |||||||||||| || |||||||| |||||||||| |
|
|
| T |
6118833 |
tgtttataatattttcagttcaattcgatcacctaaaaaaccttgt |
6118788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University