View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18482_high_35 (Length: 237)
Name: NF18482_high_35
Description: NF18482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18482_high_35 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 1e-96; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 1 - 179
Target Start/End: Complemental strand, 49766592 - 49766414
Alignment:
| Q |
1 |
atgcagatgatgaatattttagtccaagaaaaagaaatgggttttggtcttttctctatcattcttcaaaatcttcaacttcttccaagagctttagtaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49766592 |
atgcagatgatgaatattttagtccaagaaaaagaaatgggttttggtcttttctctatcattcttcaaaatcttcaacttcttccaagagctttagtaa |
49766493 |
T |
 |
| Q |
101 |
tactactgcttcagctaagcttaaggaaaagtgttgttcaggttcttctttaggaagaaagaacgacattgttattgtt |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49766492 |
tactactgcttcagctaagcttaaggaaaagtgttgttcaggttcttctttaggaagaaagaacgacattgttattgtt |
49766414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 197 - 227
Target Start/End: Complemental strand, 49766396 - 49766366
Alignment:
| Q |
197 |
taacagtcctaatagcaacaacacaggttct |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
49766396 |
taacagtcctaatagcaacaacacaggttct |
49766366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University