View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18482_high_37 (Length: 215)
Name: NF18482_high_37
Description: NF18482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18482_high_37 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 1 - 207
Target Start/End: Complemental strand, 13472509 - 13472305
Alignment:
| Q |
1 |
tccatgtaaacgacgtaaaatccgctgtattgattcatggcggacccaaagcaagtgcaaccaggccaattgtggtctcaaaaaatgttggggactcaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13472509 |
tccatgtaaacgacgtaaaatccgctgtatcgattcatggcggacccaaagcaagtgcaaccaggccaattgtggtctcaaaaaatgttggggactcaat |
13472410 |
T |
 |
| Q |
101 |
tatttatttattttgaaatcctaactaactgaacttaatcctagcacatagagagaattaattatccgtagaggatgtaactaacaaagatataaagatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
13472409 |
tatttatttattttgaaatcctaactaactgaacttaatcct--cacaaagagagaattaattacccgtagaggatgtaactaacaaagatataaagatt |
13472312 |
T |
 |
| Q |
201 |
gatgatg |
207 |
Q |
| |
|
||||||| |
|
|
| T |
13472311 |
gatgatg |
13472305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University