View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18482_low_30 (Length: 289)
Name: NF18482_low_30
Description: NF18482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18482_low_30 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 8e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 8e-98
Query Start/End: Original strand, 6 - 209
Target Start/End: Original strand, 49766675 - 49766881
Alignment:
| Q |
6 |
agaaacataggttttcttcttctttctcttagctaagagaaaaggaatacgagtttttctagaatagtattcatggtggtaatgtttaccatgattttca |
105 |
Q |
| |
|
||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49766675 |
agaaacagaggttttcttcttctttttcttagctaagagaaaaggaatacgagtttttctagaatagtattcatggtggtaatgtttaccatgattttca |
49766774 |
T |
 |
| Q |
106 |
tttttagtaggacaaacagagagtgagagagaagaagatgaagttacagcagttgtagctgatacagtgttgatg---gaagaagaagaaggacaatgac |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
49766775 |
tttttagtaggacaaacagagagtgagagagaagaagatgaagttacagcagttgttgctgatacagtgttgatggaagaagaagaagaaggacaatgac |
49766874 |
T |
 |
| Q |
203 |
gagtagt |
209 |
Q |
| |
|
||||||| |
|
|
| T |
49766875 |
gagtagt |
49766881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University