View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18482_low_32 (Length: 273)

Name: NF18482_low_32
Description: NF18482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18482_low_32
NF18482_low_32
[»] chr1 (1 HSPs)
chr1 (26-171)||(34561580-34561725)


Alignment Details
Target: chr1 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 26 - 171
Target Start/End: Original strand, 34561580 - 34561725
Alignment:
26 aaatctttgcctaaaaaggaatattttatccagatactataatctagtatagttttaggataatgtagtttgtttatattttctccgtacaaagaagtac 125  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34561580 aaatctttgcctaaaaaggaatattttatccagatactatagtctagtatagttttaggataatgtagtttgtttatattttctccgtacaaagaagtac 34561679  T
126 tcgaattgaattattccgataatggccgatggaagataaggaatcg 171  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
34561680 tcgaattgaattattccgataatggccgatggaagataaggaatcg 34561725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University