View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18482_low_36 (Length: 259)
Name: NF18482_low_36
Description: NF18482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18482_low_36 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 13 - 243
Target Start/End: Complemental strand, 52507307 - 52507077
Alignment:
| Q |
13 |
aaaattcgatgaatgtaaacaatgttttcattgcaacgtaaaaatagatttcattaattgtgatgtaaaaatagatataatattgatttgctttctgaaa |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || |
|
|
| T |
52507307 |
aaaattcgatgaatgtaaacaatgttttcattgcaacgtaaaaatagatttcattaattgtgatgtaaaaataaatataatattgatttgctttctggaa |
52507208 |
T |
 |
| Q |
113 |
ccataatttgtatctttcaaccaactaagcgatataccctaatcattcaagttaaccctccttgtaaatagcttcggtccatatttgttagtagtatttc |
212 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52507207 |
ccataatttgtatctttcaaccgactaagcgatataccctaatcattcaagttaaccctccttgtaaatagcttcggtccatatttgttagtagtatttc |
52507108 |
T |
 |
| Q |
213 |
cactttgtatctacttctcttcgttttttct |
243 |
Q |
| |
|
|||||||||||||||| |||||| ||||||| |
|
|
| T |
52507107 |
cactttgtatctacttttcttcgatttttct |
52507077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University