View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18482_low_37 (Length: 250)
Name: NF18482_low_37
Description: NF18482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18482_low_37 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 14 - 250
Target Start/End: Original strand, 31322403 - 31322639
Alignment:
| Q |
14 |
atattatgtaagatttagtcatcttagtcgtatgcacccctagccccatgatccattaaacactaattgattatgattttttataggcaaatgttagtgg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31322403 |
atattatgtaagatttagtcatcttagtcgtatgcacccctagccccatgatccattaaacactaattgattatgattttttataggcaaatgttagtgg |
31322502 |
T |
|
| Q |
114 |
taaattagtcaagggatggggaaactaatatcaacatgcatcaaactctaaattaaatattcttcttgatacttttttagcgttataacttataccaccg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31322503 |
taaattagtcaagggatggggaaactaatatcaacatgcatcaaactctaaattaaatattcttcttgatacttttttagcgttataacttataccaccg |
31322602 |
T |
|
| Q |
214 |
acctaccaataatggattgatccaagtgataagggat |
250 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
31322603 |
acctatcaataatgaattgatccaagtgataagggat |
31322639 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University