View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18482_low_38 (Length: 239)
Name: NF18482_low_38
Description: NF18482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18482_low_38 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 159; Significance: 8e-85; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 17 - 239
Target Start/End: Complemental strand, 31322849 - 31322627
Alignment:
| Q |
17 |
aagtagttatcgaagatatatttcaacatataagttttttcattttgttattatgttactgatacaaagttttcaccgtcgtttaccagtgattaatctt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||| || |||||||||||||| ||||||||||||| | ||||||| |
|
|
| T |
31322849 |
aagtagttatcgaagatatatttcaacatataagttgtttcattttgttactatgttattggtacaaagttttcactgtcgtttaccagtaactaatctt |
31322750 |
T |
|
| Q |
117 |
cattggaaaatcggtgaggtacataaggtggattttctcctttcaatcgagttttctccatacgcaagagatgatgattgaacccttaaccagttgctga |
216 |
Q |
| |
|
||||||||||||||||||||| ||||||||| || || ||||||||||||||||||||| ||| || ||||||||||||||||||||||||| ||||||| |
|
|
| T |
31322749 |
cattggaaaatcggtgaggtatataaggtgggttctcccctttcaatcgagttttctccttacacaggagatgatgattgaacccttaaccacttgctga |
31322650 |
T |
|
| Q |
217 |
aggtgtccaaatcccttatcact |
239 |
Q |
| |
|
|||||| |||||||||||||||| |
|
|
| T |
31322649 |
aggtgttcaaatcccttatcact |
31322627 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 59 - 119
Target Start/End: Original strand, 42563705 - 42563765
Alignment:
| Q |
59 |
ttttgttattatgttactgatacaaagttttcaccgtcgtttaccagtgattaatcttcat |
119 |
Q |
| |
|
|||| ||| |||| || |||||||||||||| ||| ||||||| ||||||||||||||||| |
|
|
| T |
42563705 |
tttttttactatgatattgatacaaagtttttaccctcgtttaacagtgattaatcttcat |
42563765 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University