View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18482_low_41 (Length: 220)
Name: NF18482_low_41
Description: NF18482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18482_low_41 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 18 - 126
Target Start/End: Complemental strand, 38953010 - 38952902
Alignment:
| Q |
18 |
ggctagtcaggatgctgatggtggcagaggtctccaaaatatttgtggtctcactaattactgactgaagcattggctggagattatagggggttttgga |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
38953010 |
ggctagtcaggatgctgatggtggcagaggtctccaaaatatttgtggtctcactaattactgactgaagcattggctggagattatagggggctttgga |
38952911 |
T |
 |
| Q |
118 |
aaaggtaac |
126 |
Q |
| |
|
||||||||| |
|
|
| T |
38952910 |
aaaggtaac |
38952902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University