View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18484_low_12 (Length: 319)
Name: NF18484_low_12
Description: NF18484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18484_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 1 - 296
Target Start/End: Original strand, 24624169 - 24624466
Alignment:
| Q |
1 |
agctagttcttcaagggcacgtgcacaagaaccattttatcctttaaaattcgaaggtacttaccaacaagaacaatgcagagagttggtggagcgggaa |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
24624169 |
agctagttcttcaagggcacgcgcacaagaaccattttatcctttaaaattcaaaggtacttaccaacaagaacaatgcagaacgttggtggagcgggaa |
24624268 |
T |
 |
| Q |
101 |
atgtgggtggagaaggaattctgaatcaaagaaaaaggaccgtatatgggcatag--caaataatccacaccaggaattgggataagttggtagatcttc |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
24624269 |
atgtgggtggagaaggaattctgaatcaaagaaaaaggaccgtgtatgggcatagcacaaataatctacaccaggaattgggataagttggtagatcttc |
24624368 |
T |
 |
| Q |
199 |
ccaagcttctaaataatgatgtgatccgggagatatatgtcaatgctcttccatccgatgatgaacccttttctttcaccaatgtggttcgtggacga |
296 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24624369 |
ccaagcttctaaataatgatgtaatccgggagatatatgtcaatgctcttccatccgatgatgaacccttttctttcaccaatgtggttcgtggacga |
24624466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University