View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18484_low_13 (Length: 313)
Name: NF18484_low_13
Description: NF18484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18484_low_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 18 - 299
Target Start/End: Original strand, 35205709 - 35205990
Alignment:
| Q |
18 |
agagttaagcaccttagaatgcttcttatgaagcaataacaacccgaaaattgcaagcaccgcgttcttttttcctcgaattgttcctttctttatcaat |
117 |
Q |
| |
|
||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35205709 |
agagttaagtaccttagaatgattcttatgaagcaataacaacccgaaaattgcaagcaccgcgttcttttttcctcgaattgttcctttctttatcaat |
35205808 |
T |
|
| Q |
118 |
tcaactaaaccagaaactgcctctgaattttcgcctattaattttctgtactctttcactgaagtgaggtaaaatattataccagctgcaactcgacggg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35205809 |
tcaactaaaccagaaactgcctctgaattttcgcctattaattttctgtactctttcactgaagtgaggtaaaatattataccagctgcaactcgacggg |
35205908 |
T |
|
| Q |
218 |
cttctaaactaaatccttttctgagaactgtaacaataggttttaaacctctactctccatgataacttcgcggccattagt |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35205909 |
cttctaaactaaatccttttctgagaactgtaacaataggttttaaacctctactctccatgataacttcgcggccattagt |
35205990 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 144 - 221
Target Start/End: Original strand, 43985528 - 43985605
Alignment:
| Q |
144 |
attttcgcctattaattttctgtactctttcactgaagtgaggtaaaatattataccagctgcaactcgacgggcttc |
221 |
Q |
| |
|
|||||| |||||||||||||| || |||||||||||| || || ||||||||| | ||||||| | |||||||||| |
|
|
| T |
43985528 |
attttcacctattaattttctatattctttcactgaacaaagatagaatattatagctgctgcaatttgacgggcttc |
43985605 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University