View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18484_low_21 (Length: 214)
Name: NF18484_low_21
Description: NF18484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18484_low_21 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 173
Target Start/End: Original strand, 22735222 - 22735394
Alignment:
| Q |
1 |
cacacactattccttaataaaatctactattagtacgtatcaaatatcaatgatttcatctgtcttgtacgaaaaaggatggaaaagaaaagtgaaatgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22735222 |
cacacactattccttaataaaatctactattagtacgtatcaaatatcaatgattttatttgtcttgtacgaaaaaggatggaaaagaaaagtgaaatgc |
22735321 |
T |
 |
| Q |
101 |
aggagaggggataacgaatgtgcttgtttgaatccagaaatagatgttttaattctatgattgaaatatcttt |
173 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22735322 |
aggagaggggataacgaatgtgcttgtttgaatccagaaatagatgttttaattctatgattgaaatatcttt |
22735394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University