View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18485_high_13 (Length: 257)
Name: NF18485_high_13
Description: NF18485
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18485_high_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 18 - 254
Target Start/End: Complemental strand, 32189483 - 32189247
Alignment:
| Q |
18 |
aatgagatgctcatgatgatgataaaaattaattcaaagnnnnnnnncaagaaatttgatgtaagaattggaatcgattagtactacgtcgactttggtg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32189483 |
aatgagatgctcatgatgatgataaaaattaattcaaagaaaaaaaacaagaaatttgatgtaagaattggaatcgattagtactacgtcgactttggtg |
32189384 |
T |
|
| Q |
118 |
ggagacttttgattcagataacaactaacgtactaatatttgtctacacgaaaaattgttggagaggtgattttatgtttggtgatttggaggaatgtga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32189383 |
ggagacttttgattcagataacaactaacgtactaatatttgtctatacgaaaaattattggagaggtgattttatgtttggtgatttggaggaatgtga |
32189284 |
T |
|
| Q |
218 |
ttgtgaagggctaaggtagcacaggttctgctcgttc |
254 |
Q |
| |
|
||||||||||||||||| ||| ||||| |||| |||| |
|
|
| T |
32189283 |
ttgtgaagggctaaggttgcataggttgtgctagttc |
32189247 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University