View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18485_high_17 (Length: 201)

Name: NF18485_high_17
Description: NF18485
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18485_high_17
NF18485_high_17
[»] chr3 (1 HSPs)
chr3 (9-137)||(3098382-3098510)


Alignment Details
Target: chr3 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 9 - 137
Target Start/End: Original strand, 3098382 - 3098510
Alignment:
9 gtcgaagaatatgattgaataaccaaactaatattcattacattgtttttcttgttttttgcaatattaaagatgaatatgtttggtaaccaaaaaactg 108  Q
    |||| |||| ||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
3098382 gtcgtagaaaatgtttgaataaccaaactaatattcattacattgtttttcttgtttttggcaatattaaagatgaatatgtttggtaaccaaaaaactg 3098481  T
109 atgcataggttgactcttcttgatggctt 137  Q
    |||||||||||||||||||||||||||||    
3098482 atgcataggttgactcttcttgatggctt 3098510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University