View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18485_low_16 (Length: 237)
Name: NF18485_low_16
Description: NF18485
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18485_low_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 107; Significance: 9e-54; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 79 - 201
Target Start/End: Original strand, 39602557 - 39602679
Alignment:
| Q |
79 |
gaggaacataaacatgcgtagtgacaaaatgatgacggagtgggcatctgcgaacatagtgactccggctgaaatacgaacacaaacaaaatgcagtgac |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
39602557 |
gaggaacataaacatgcgtagtgacaaaatgatgacggagtggacatctgagaacatagtgactccggctgaaatacgaacacaaataaaatgaagtgac |
39602656 |
T |
 |
| Q |
179 |
gaagtgaggacccgaaagtggcg |
201 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
39602657 |
gaagtgaggacccgaaagtggcg |
39602679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University