View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18485_low_17 (Length: 228)
Name: NF18485_low_17
Description: NF18485
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18485_low_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 18 - 213
Target Start/End: Original strand, 41849661 - 41849840
Alignment:
| Q |
18 |
ttttatatatcaaaatatgtatgaattatgcaatatagcaaattgttgcatagagtgataggctagttagtgatgagcgagtgttaatattttcaggtga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
41849661 |
ttttatatatcaaaatatgtatgaattatgcaatatagaaaattgtt----------------tagttagtgatgagcgggtgttaatattttcaggtga |
41849744 |
T |
|
| Q |
118 |
atttgaagtttgaacctgagtagcagcagtaacgggaaatgaagcagaagtaacagcataagctgcaagaataccacaggcaacacccttgatttt |
213 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41849745 |
atttgaggtttgaacctgagtagcagcagtaacgggaaatgaagcagaagtaacagcataagctgcaagaataccacaggcaacacccttgatttt |
41849840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University