View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18485_low_18 (Length: 201)
Name: NF18485_low_18
Description: NF18485
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18485_low_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 9 - 137
Target Start/End: Original strand, 3098382 - 3098510
Alignment:
| Q |
9 |
gtcgaagaatatgattgaataaccaaactaatattcattacattgtttttcttgttttttgcaatattaaagatgaatatgtttggtaaccaaaaaactg |
108 |
Q |
| |
|
|||| |||| ||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3098382 |
gtcgtagaaaatgtttgaataaccaaactaatattcattacattgtttttcttgtttttggcaatattaaagatgaatatgtttggtaaccaaaaaactg |
3098481 |
T |
 |
| Q |
109 |
atgcataggttgactcttcttgatggctt |
137 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
3098482 |
atgcataggttgactcttcttgatggctt |
3098510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University