View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18485_low_3 (Length: 544)
Name: NF18485_low_3
Description: NF18485
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18485_low_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 394; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 394; E-Value: 0
Query Start/End: Original strand, 6 - 497
Target Start/End: Complemental strand, 51771284 - 51770789
Alignment:
| Q |
6 |
aggagcagagagaaagttgaaaatggcctttcaccggccttccccaaaacttgctcaatgcctgcaaatactattactgtctctataccctaaccaatcg |
105 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51771284 |
aggaacagagagaaagttgaaaatggcctttcaccggccttccccaaaacttgctcaatgcctgcaaatactattactgtctctataccctaaccaatcc |
51771185 |
T |
 |
| Q |
106 |
attttcccattttagaaaacaacactctttctctctcaagtagtaacatcaagaaagggaga----gtgagtgagagaagcaattagcagcaataacatc |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
51771184 |
attttcccattttagaaaacaacactctttctctctcaagtagtaacatcaagaaagggagagtgtgtgagtgagagaagcaattagcagcaataacatc |
51771085 |
T |
 |
| Q |
202 |
attatcgactgaaagacaagaagaaggcttggcttgactatcatcattttcattctgttttacagccaccagcaatggatgtgtttgtggtggacacggt |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
51771084 |
attatcgactgaaagacaagaagaaggcttggcttgactatcatcattttcattctgttttacagctaccagcaatggatgtgtttgtggtggacacggt |
51770985 |
T |
 |
| Q |
302 |
ggcggtggttgtttcatcttcttccacnnnnnnnnnnnnnnnnnnnctagcagcaacatgcaatgacccttatacccttgctcacaaacaggtggtggtt |
401 |
Q |
| |
|
||||||||||||||||||||||||||| || |||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51770984 |
ggcggtggttgtttcatcttcttccacagtagtagtagtagtagtagtactagcagcatgcaatgacccttatacccttgctcacaaacaggtggtggtt |
51770885 |
T |
 |
| Q |
402 |
ctctttgcaaatccaacaacaacctcgttgctcatcagacattgacatcgtaccattgcatttgcgtccattaaggcagacaggttgaagccaggc |
497 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51770884 |
ctctttgcaaatccaacaacaacctcgttgctcatcagacattgacatcgtaccattgcatttgcgtccattaaggcagacaggttgaagccaggc |
51770789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University