View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18486_high_19 (Length: 249)
Name: NF18486_high_19
Description: NF18486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18486_high_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 77; Significance: 8e-36; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 7 - 126
Target Start/End: Original strand, 3931517 - 3931633
Alignment:
| Q |
7 |
ctaaagtaagaaaatcaagagggccaagccaaaacacaaagacagtgctttttattgaattttttattcttcccttcaaatnnnnnnnttaaattcagac |
106 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||| |||| |
|
|
| T |
3931517 |
ctaaagtaagaaaatcaag---gccaagccaaaacacaaagacagtgctttttattgaattttttaatcttcccttcaaataaaaaaattaaattgagac |
3931613 |
T |
 |
| Q |
107 |
gacgggctaaagtgtcatgg |
126 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
3931614 |
gacgggctaaagtgtcatgg |
3931633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 136 - 237
Target Start/End: Original strand, 3931824 - 3931924
Alignment:
| Q |
136 |
atgaactgaaaattgttttcttttcatgtattgaagtgagtctcaaattttgtcttcgtaacaacttaaaaacnnnnnnngcaagttttcttttgatact |
235 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| ||||||||| |||||| |||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
3931824 |
atgaacggaaaattgttttcttttcatgtattgaggtgagtctc-aattttatctttgtaacaacttaaaaacttcttttgcaagttttcttttgatact |
3931922 |
T |
 |
| Q |
236 |
ct |
237 |
Q |
| |
|
|| |
|
|
| T |
3931923 |
ct |
3931924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University