View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18486_high_22 (Length: 208)
Name: NF18486_high_22
Description: NF18486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18486_high_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 201
Target Start/End: Complemental strand, 4729932 - 4729732
Alignment:
| Q |
1 |
ctcgttataaaatcgattggcatcaggcttgtgggataaagtgagtggctcattttctgcggtcgccagttttgcacattgtaatttttctttactttgc |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
4729932 |
ctcgttataaaattgattggcatcaggcttgtgggataaagtgagtggctcattttctgcagtcaccagttttgcacattgtaatttttctttactttgc |
4729833 |
T |
 |
| Q |
101 |
aggttacaagtaatatgccatgttaacgtagttgtacagctagtgcgcgaagctctttcccaatggaaatctattcgtacaaaagacaatcagggagtgc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4729832 |
aggttacaagtaatatgccatgttaacgtagttgtacagctagtgcgcgaagctctttcccaatggaaatctattcgtgcaaaagacaatcagggagtgc |
4729733 |
T |
 |
| Q |
201 |
a |
201 |
Q |
| |
|
| |
|
|
| T |
4729732 |
a |
4729732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University