View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18486_high_8 (Length: 349)
Name: NF18486_high_8
Description: NF18486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18486_high_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 300; Significance: 1e-169; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 300; E-Value: 1e-169
Query Start/End: Original strand, 19 - 326
Target Start/End: Original strand, 30769169 - 30769476
Alignment:
| Q |
19 |
gatcttgcgttgtaattagcaatttagcactctatattggcaaataaagcagacattataagtttccaatgttattttgttccttttgcattgctttaag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30769169 |
gatcttgcgttgtaattagcaatttagcactctatattggcaaataaagcagacattataagtttccaatgttattttgttccttttgcattgctttaag |
30769268 |
T |
|
| Q |
119 |
gttgtgtatattgataggacttatgttgaacacgttagttgttcgacttatgttctaacacattagttttttgagtgttgaaacactcttatcaaatcaa |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30769269 |
gttgtgtatattgataggacttatgttgaacacattagttgttcgacttatgttctaatacattagttttttgagtgttgaaacactcttatcaaatcaa |
30769368 |
T |
|
| Q |
219 |
atttacttaagtgagagcatagtttggttatttgtacgatgagtaaattcactagtcttgtaatttcttactttggtttgctgaaatgaatgcatatata |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30769369 |
atttacttaagtgagagcatagtttggttatttgtacgatgagtaaattcactagtcttgtaatttcttactttggtttgctgaaatgaatgcatatata |
30769468 |
T |
|
| Q |
319 |
ggatgcaa |
326 |
Q |
| |
|
|||||||| |
|
|
| T |
30769469 |
ggatgcaa |
30769476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 55 - 112
Target Start/End: Original strand, 30773056 - 30773113
Alignment:
| Q |
55 |
ttggcaaataaagcagacattataagtttccaatgttattttgttccttttgcattgc |
112 |
Q |
| |
|
||||||||||||||| || | || ||||| || || |||||||||||||||||||||| |
|
|
| T |
30773056 |
ttggcaaataaagcaaacttgattagtttgcagtgctattttgttccttttgcattgc |
30773113 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University