View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18486_low_13 (Length: 307)
Name: NF18486_low_13
Description: NF18486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18486_low_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 20 - 253
Target Start/End: Original strand, 44552540 - 44552773
Alignment:
| Q |
20 |
aatggattggtagctatagtttattgatggctgcattttgtgaggaagggaggatataagattgtggctagttgtggaaagaaatgataaggaaattgaa |
119 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
44552540 |
aatggattgttagctatagtttattgatggctgcattttgtgaggaagggaggatataagattgtgggtagttgtggaaagaaatgataaggaaattgag |
44552639 |
T |
 |
| Q |
120 |
acttatgtgataagttgtggaaagaaattacgaagaaggtgcaagtgtttttacctgggtttctttgaagaagattgatgaacatgatcatcaagatgaa |
219 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44552640 |
ccttatgtgataagttgtggaaataaattacgaagaaggtgtaagtgtttttacctggggttctttgaagaagattgatgaacatgatcatcaagatgaa |
44552739 |
T |
 |
| Q |
220 |
caataagagatgaaataagatgaaaaaatggaga |
253 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
44552740 |
caataagagatggaataagatgaaaaaatggaga |
44552773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University