View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18487_high_2 (Length: 277)
Name: NF18487_high_2
Description: NF18487
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18487_high_2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 218; Significance: 1e-120; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 11 - 257
Target Start/End: Original strand, 23756059 - 23756307
Alignment:
| Q |
11 |
cacagaacactagctcacacacacttagctcaatgatacccctaaagtaggagtgcttatgtagactctattatggccctactttgatcgtaatttattg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23756059 |
cacagaacactagctcacacacacttagctcaatgatacccctaaactaggagtgcttatgtagactctattatggccctactttgatcgtaatttattg |
23756158 |
T |
|
| Q |
111 |
gtttaattcaacttttgaattggatgggtcgaccgaccctcgtgcttgggggattgtagaccgaatgtgacttcgcctataggcccatcgctccccgtgc |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23756159 |
gtttaattcaacttttgaattggatgggtcgaccgaccctcgtgcttgggggattgtagactgaatgtgacttcgcctataggcccatcgctccccgtgc |
23756258 |
T |
|
| Q |
211 |
ctggtcg--aagagacgaagcgcaagacccgaacaccttgatcacatag |
257 |
Q |
| |
|
||||| | ||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
23756259 |
ctggttggagagagacgaagcgcaagacccgaacaccttgatcgcatag |
23756307 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 11 - 54
Target Start/End: Original strand, 23779791 - 23779834
Alignment:
| Q |
11 |
cacagaacactagctcacacacacttagctcaatgataccccta |
54 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
23779791 |
cacagaacactagctcgtacacacttagctcaatgatgccccta |
23779834 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 15 - 68
Target Start/End: Original strand, 33279178 - 33279231
Alignment:
| Q |
15 |
gaacactagctcacacacacttagctcaatgatacccctaaagtaggagtgctt |
68 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| |||||||| || |||||||| |
|
|
| T |
33279178 |
gaacactagctcgtacacacttagctcaatgatgcccctaaactacgagtgctt |
33279231 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University