View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18489_high_22 (Length: 272)
Name: NF18489_high_22
Description: NF18489
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18489_high_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 170; Significance: 3e-91; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 74 - 259
Target Start/End: Complemental strand, 52204844 - 52204659
Alignment:
| Q |
74 |
caagaacatcagattcacttgaaacctgtcagcatatgaaaacacgttaaaacatatcaaaaaagaaatgcgggagttcaaacgaacaaaaataggtatg |
173 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52204844 |
caagaacatcagattcacttgaaacctgtcaacatatgaaaacacattaaaacatatcaaaaaagaaatgcgggagttcaaacgaacaaaaataggtatg |
52204745 |
T |
 |
| Q |
174 |
cgtcggtaaaccttaaggttatgcttgcttataaactgctcaattatgtcatcctcagctgtagctttcttgactgcatagtacct |
259 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
52204744 |
cgtcggtaaaccttaaggttatgctttcttataaactgctcaattatgtcatcctcagctgtagctttcttgactgtatagtacct |
52204659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 18 - 76
Target Start/End: Complemental strand, 52204930 - 52204872
Alignment:
| Q |
18 |
cataatccttatacccattcattatattataggtgggcacaatacctgattttcaacaa |
76 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52204930 |
cataatccttatacccattcattatattataggtgggcacaatacctgattttcaacaa |
52204872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University