View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18489_high_26 (Length: 243)
Name: NF18489_high_26
Description: NF18489
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18489_high_26 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 3 - 219
Target Start/End: Complemental strand, 25117648 - 25117432
Alignment:
| Q |
3 |
aaacaaagtgttttgttggtataatatataaaataagatataagatagttatatggttggaacatggaagctaggttttgttatgatgataatatataaa |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
25117648 |
aaacaaagtgttttgttggtataatatataagataagatataagatagttatatggttggaactaggaagctaggttttgttatgatgataatatataaa |
25117549 |
T |
 |
| Q |
103 |
agggtgaaggattgagatcactaattgtttttgaatgaaacttgtgagttagaatatgaaggatgaaaaaggtggtggtttggtctaaaaggagaaggag |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
25117548 |
agggtgaaggattgagatcactaattgtttttgaatgaaacttgtgagttagaatatgaaggatgaaaaaggtggtggcttggtctaaaaggagaaggag |
25117449 |
T |
 |
| Q |
203 |
agaaagaggggacgagg |
219 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
25117448 |
agaaagaggggacgagg |
25117432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University