View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18489_high_29 (Length: 236)
Name: NF18489_high_29
Description: NF18489
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18489_high_29 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 54; Significance: 4e-22; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 168 - 236
Target Start/End: Original strand, 46936517 - 46936586
Alignment:
| Q |
168 |
gccagcagtaaaaactaaagcagcaccctgggaacttacttgaattactttg-cgacaagactaacatcc |
236 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
46936517 |
gccagcagtaaaaactaaagcagcaccccgggaacttacttgaattacttcgtcgacaagactaacatcc |
46936586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 63 - 96
Target Start/End: Original strand, 46936482 - 46936515
Alignment:
| Q |
63 |
atttaagaagtccataattggctttttgtgcatt |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
46936482 |
atttaagaagtccataattggctttttgtgcatt |
46936515 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University