View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18489_low_12 (Length: 460)

Name: NF18489_low_12
Description: NF18489
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18489_low_12
NF18489_low_12
[»] chr7 (2 HSPs)
chr7 (178-279)||(42859345-42859446)
chr7 (369-449)||(42859540-42859615)


Alignment Details
Target: chr7 (Bit Score: 90; Significance: 3e-43; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 90; E-Value: 3e-43
Query Start/End: Original strand, 178 - 279
Target Start/End: Original strand, 42859345 - 42859446
Alignment:
178 taatcgaaatttacattaacctctcttcaagatactagcgggcttgaacccaaaactttcaaatttaacatccatctttttaccactaaattaaacctag 277  Q
    ||||||||||||||||||||||||||| |||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
42859345 taatcgaaatttacattaacctctcttgaagatactagcgggtttgaacccaagactttcaaatttaacatccatctttttaccactaaattaaacctag 42859444  T
278 ag 279  Q
    ||    
42859445 ag 42859446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 369 - 449
Target Start/End: Original strand, 42859540 - 42859615
Alignment:
369 tttcattttggtcacttagcttaaaaatatcagatgttttgatcttttaaactataaaatttagatatttcggtcattcat 449  Q
    |||||||||||||||||| ||||||||||| |||||||||||||||||||     ||||| |||| |||||||||||||||    
42859540 tttcattttggtcacttaacttaaaaatattagatgttttgatcttttaa-----aaaatgtagacatttcggtcattcat 42859615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University