View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18489_low_23 (Length: 269)
Name: NF18489_low_23
Description: NF18489
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18489_low_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 17 - 255
Target Start/End: Complemental strand, 33397125 - 33396887
Alignment:
| Q |
17 |
agagacactgaagaaaaagcatgtagaggaagagaagcatcgatcgacgaacacgagtgtttgaaatggctacaatcaaaagaaccaaattcagttattt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33397125 |
agagacactgaagaaaaagcatgtagaggaagagaagcatcgatcgacgaacacgagtgtttgaaatggctacaatcaaaagaaccaaattcagttattt |
33397026 |
T |
 |
| Q |
117 |
atgtttgttttggtagcatgacggttttcagcgacgctcagcttaaggaaattgcaatgggacttgaagcttctgaagttccattcatttgggttgtgag |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33397025 |
atgtttgttttggtagcatgacggttttcagcgacgctcagcttaaggaaattgcaatgggacttgaagcttctgaagttccattcatttgggttgtgag |
33396926 |
T |
 |
| Q |
217 |
gaaaagtgctaaaagtgaaggtgaaaatttggaatggct |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33396925 |
gaaaagtgctaaaagtgaaggtgaaaatttggaatggct |
33396887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University