View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18489_low_25 (Length: 249)
Name: NF18489_low_25
Description: NF18489
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18489_low_25 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 223; Significance: 1e-123; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 25117895 - 25118133
Alignment:
| Q |
1 |
aaggcctaaccacagaagcagcaaacataataaagcaagcaataaccctagcaaagcgtcgtggccatgctcaagtaacaccacttcatgttgcaaacac |
100 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
25117895 |
aaggcctaacaacagaagctgcaaacataataaagcaagcaataaccctagcaaagcgtcgtggccatgctcaagtaacaccacttcatgttgcaaatac |
25117994 |
T |
 |
| Q |
101 |
tatgcttagtgttaccaatggattattaagaacagcttgtcttcaatctcactctcaccctcttcaatgcaaggctttagagctttgcttcaatgtcgca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25117995 |
gatgcttagtgttaccaatggattattaagaacagcttgtcttcaatctcactctcaccctcttcaatgcaaggctttagagctttgcttcaatgtcgca |
25118094 |
T |
 |
| Q |
201 |
ctcaatcgtttgccagcgacgacttgtaatagccctatg |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25118095 |
ctcaatcgtttgccagcgacgacttgtaatagccctatg |
25118133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 126 - 211
Target Start/End: Complemental strand, 40588860 - 40588775
Alignment:
| Q |
126 |
ttaagaacagcttgtcttcaatctcactctcaccctcttcaatgcaaggctttagagctttgcttcaatgtcgcactcaatcgttt |
211 |
Q |
| |
|
||||||| |||||||||||||| |||||||||||||||||||||||| ||| | |||||||| |||||||| |||||||| ||||| |
|
|
| T |
40588860 |
ttaagaaaagcttgtcttcaatgtcactctcaccctcttcaatgcaaagctcttgagctttgtttcaatgttgcactcaaccgttt |
40588775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University