View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18489_low_27 (Length: 239)
Name: NF18489_low_27
Description: NF18489
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18489_low_27 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 4 - 229
Target Start/End: Complemental strand, 4318664 - 4318438
Alignment:
| Q |
4 |
agagcctagtagacacacgtattttgtaaaactactattactagcttcttgtttcacaaaaaatcgaacactaaacgtgcgactacaatgaccaaccgca |
103 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
4318664 |
agagcctagtagacacacgtcttttgtaaaactactattactagcttcttgtttcacaaaaaatggaacactaaacgtgcgactacaatgaccaaccgca |
4318565 |
T |
 |
| Q |
104 |
aaaccaaacgtagcatttgaagacggtctaatccaaac-aaaacnnnnnnnngataaatgtcgtgtaacttactcaatgattaatcttatagcgcgtcta |
202 |
Q |
| |
|
||| |||||||||||||||||||||||| || |||||| |||| ||||||||||||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
4318564 |
aaatcaaacgtagcatttgaagacggtccaacccaaacaaaaagaaaaataagataaatgtcgtgtagcttacttaatgattaatcttatagcgcgtcta |
4318465 |
T |
 |
| Q |
203 |
aatgacctaaatcatgatgaagaaaag |
229 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
4318464 |
aatgacctaaatcatgatgaagaaaag |
4318438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University