View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1848_high_8 (Length: 209)
Name: NF1848_high_8
Description: NF1848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1848_high_8 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 164; Significance: 8e-88; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 16 - 191
Target Start/End: Complemental strand, 13408427 - 13408252
Alignment:
| Q |
16 |
gcaacatgtgttagagctgaaaccatttctgataactctctatcaccattataccctgaaaacatttggttgaaatctaactgtgatgcattagaacttc |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
13408427 |
gcaacatgtgttagagctgaaaccatttctgataactctctatcaccattataccctgaaaacatttggttgaaatccaactgtgatgcattagaacttc |
13408328 |
T |
 |
| Q |
116 |
caccgtcgttgctaccaccgtcgtgatcgtcgccttcgcgcttcaccgtgtacccggtgaactcacctgaacctct |
191 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13408327 |
caccgtcgtcgctaccaccttcgtgatcgtcgccttcgcgcttcaccgtgtacccggtgaactcacctgaacctct |
13408252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 129 - 167
Target Start/End: Complemental strand, 12064784 - 12064746
Alignment:
| Q |
129 |
accaccgtcgtgatcgtcgccttcgcgcttcaccgtgta |
167 |
Q |
| |
|
||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
12064784 |
accactgtcgtgatcgtcgccttcgcacttcaccgtgta |
12064746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University