View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1848_low_1 (Length: 456)
Name: NF1848_low_1
Description: NF1848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1848_low_1 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 246; Significance: 1e-136; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 194 - 447
Target Start/End: Complemental strand, 43449799 - 43449546
Alignment:
| Q |
194 |
cgaatggcggagctggagttggaaacggcgctttcgagagcttctgaggcgaggttgagttgttttaaggttacttgattggtgattggagtttctcggt |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43449799 |
cgaatggcggagctggagttggaaacggcgctttcgagagcttctgaggcgaggttgagttgttttaaggttacttgattggtgattggagtttctcggt |
43449700 |
T |
 |
| Q |
294 |
ggagagtttcaatgaggtggcgacggagttgtgattgatgaataacgccggtgatgaatgcggtagtgtaacggaggatttgagttcgtgttgtgttcat |
393 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43449699 |
ggagagtttcaatgaggtggcgacggagttgtgattgatgaataacgccggtgatgaatgcggtagtgtaacggaggatttgagttcgtgttgtgttcat |
43449600 |
T |
 |
| Q |
394 |
ggcggtggtttttgatcggaatgggaatgagtgaaatgaggtttatgatgatgt |
447 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
43449599 |
ggcggtggtttttgatcggaatgggaatgagtgaaatgaggtttacgacgatgt |
43449546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 101; E-Value: 7e-50
Query Start/End: Original strand, 1 - 101
Target Start/End: Complemental strand, 43449992 - 43449892
Alignment:
| Q |
1 |
aagatgctcgtagagagacggtgctatttcagatcgagcgagtgaaggattggaatgaaagattctgaggagaatgatggcagattcttcggcgtggtta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43449992 |
aagatgctcgtagagagacggtgctatttcagatcgagcgagtgaaggattggaatgaaagattctgaggagaatgatggcagattcttcggcgtggtta |
43449893 |
T |
 |
| Q |
101 |
c |
101 |
Q |
| |
|
| |
|
|
| T |
43449892 |
c |
43449892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University