View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1848_low_11 (Length: 207)
Name: NF1848_low_11
Description: NF1848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1848_low_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 7 - 190
Target Start/End: Complemental strand, 4966244 - 4966060
Alignment:
| Q |
7 |
ttcgggacccgtt-ggtcttggacatagcatttcattatttcagtcactgtatggacggactttgtctcattattatttatttctttaaaaggccaaaat |
105 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
4966244 |
ttcgggacccgtttggtcttggacatagcatttcattatttcagtccctgtatggac----tttgtctcattattatttatttctttaaaagaccaaaat |
4966149 |
T |
|
| Q |
106 |
gaactatat--tataactaaaataataaga--tctttcggaacaagctctatatgaaagaacttattaactgagtaaagttacatcaca |
190 |
Q |
| |
|
||||||||| ||||||||||| ||||||| |||||| | |||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
4966148 |
gaactatatattataactaaaagaataagagatctttcagcacaagctctatatgaaagaacttattaactgagtcaagttacatcaca |
4966060 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University