View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1848_low_11 (Length: 207)

Name: NF1848_low_11
Description: NF1848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1848_low_11
NF1848_low_11
[»] chr5 (1 HSPs)
chr5 (7-190)||(4966060-4966244)


Alignment Details
Target: chr5 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 7 - 190
Target Start/End: Complemental strand, 4966244 - 4966060
Alignment:
7 ttcgggacccgtt-ggtcttggacatagcatttcattatttcagtcactgtatggacggactttgtctcattattatttatttctttaaaaggccaaaat 105  Q
    ||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||    ||||||||||||||||||||||||||||||| |||||||    
4966244 ttcgggacccgtttggtcttggacatagcatttcattatttcagtccctgtatggac----tttgtctcattattatttatttctttaaaagaccaaaat 4966149  T
106 gaactatat--tataactaaaataataaga--tctttcggaacaagctctatatgaaagaacttattaactgagtaaagttacatcaca 190  Q
    |||||||||  ||||||||||| |||||||  |||||| | |||||||||||||||||||||||||||||||||| |||||||||||||    
4966148 gaactatatattataactaaaagaataagagatctttcagcacaagctctatatgaaagaacttattaactgagtcaagttacatcaca 4966060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University